Review



pselect zeo hsv1tk  (InvivoGen)


Bioz Verified Symbol InvivoGen is a verified supplier
Bioz Manufacturer Symbol InvivoGen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    InvivoGen pselect zeo hsv1tk
    Pselect Zeo Hsv1tk, supplied by InvivoGen, used in various techniques. Bioz Stars score: 94/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pselect+zeo+hsv1tk/pSELECT-zeo-HSV1tk/pmc13013431-36-1-2
    Average 94 stars, based on 10 article reviews
    pselect zeo hsv1tk - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Paramyxovirus vector
    Article Snippet: .. 27) Construction of SeV18+DGFP(HNL)HSV-TK/PmiR302T4-TSΔF Vector A PCR reaction was carried out using pSELECT-zeo-HSV1tk (InvivoGen, Inc.) as a template and using primers NotI-HSVtk-N (5′-ATATGCGGCCGCGACGTCACCATGGCTTCTTACCCTGGAC-3′) (SEQ ID NO:100) and HSVtk-EIS-NotI-C (5′-ATATGCGGCCGCGATGAACTTTCACCCTAAGTTTTTCTTACTACGGTTAGTTGGCCTCTCCCAT CTCCC-3′) (SEQ ID NO:101), and thus HSVtk-NotI fragment was obtained. ..

    Article Title: The precision strategy of human genome correction via a set of circular donor DNA and its cleaver
    Article Snippet: .. First, pSelect-zeo-HSV1tk (InvivoGen), cleaved by EcoRI and PstI to remove the ZEO gene, was ligated with the fragment including the Km R gene constructed using KOD-PLUS-DNA polymerase (TOYOBO)-driving PCR on the pCR-BluntII-TOPO plasmid DNA (Invitrogen) with the primer pair 5′-CTT AAT TAA CCT GCA GCC GGA ATT GCC AGC TG-3′ and 5′-ATG TGG TAT GGA ATT CGG TGG CCC TCC TCA CGT GC-3′ using the In-Fusion kit (TOYOBO) to obtain pSelect-Km-HSV1tk (1). .. On the other hand, pSelect-zeo-HSV1tk plasmid DNA (InvivoGen), cleaved by NcoI and SphI followed by blunt-ended treatment with T4 DNA polymerase with dNTPs at 11 °C, was ligated with the fragment including the Hyg gene constructed using KOD-PLUS-DNA polymerase (TOYOBO)-driving PCR on pcDNA3.1/Hygro plasmid with the primer pair 5′-TCA CCG GTC ACC ATG AAA AAG CCT GAA CTC ACC GCG-3′ and 5′-TCA AAG GCA GAA GCA ACT TCT ACA CAG CCA TCG GTC C-3′ using the In-Fusion kit (TOYOBO) to obtain pSelect-zeo-HygTK (28–10), which contains the fusion gene of Hyg and HSV1tk genes.

    Transfection:

    Article Title: A highly efficient non-viral process for programming mesenchymal stem cells for gene directed enzyme prodrug cancer therapy
    Article Snippet: .. AT-, BM- and UC-MSCs were transfected by pSELECT-zeo-HSV1tk (InvivoGen) in the presence of Enhancer. ..

    Construct:

    Article Title: The precision strategy of human genome correction via a set of circular donor DNA and its cleaver
    Article Snippet: .. First, pSelect-zeo-HSV1tk (InvivoGen), cleaved by EcoRI and PstI to remove the ZEO gene, was ligated with the fragment including the Km R gene constructed using KOD-PLUS-DNA polymerase (TOYOBO)-driving PCR on the pCR-BluntII-TOPO plasmid DNA (Invitrogen) with the primer pair 5′-CTT AAT TAA CCT GCA GCC GGA ATT GCC AGC TG-3′ and 5′-ATG TGG TAT GGA ATT CGG TGG CCC TCC TCA CGT GC-3′ using the In-Fusion kit (TOYOBO) to obtain pSelect-Km-HSV1tk (1). .. On the other hand, pSelect-zeo-HSV1tk plasmid DNA (InvivoGen), cleaved by NcoI and SphI followed by blunt-ended treatment with T4 DNA polymerase with dNTPs at 11 °C, was ligated with the fragment including the Hyg gene constructed using KOD-PLUS-DNA polymerase (TOYOBO)-driving PCR on pcDNA3.1/Hygro plasmid with the primer pair 5′-TCA CCG GTC ACC ATG AAA AAG CCT GAA CTC ACC GCG-3′ and 5′-TCA AAG GCA GAA GCA ACT TCT ACA CAG CCA TCG GTC C-3′ using the In-Fusion kit (TOYOBO) to obtain pSelect-zeo-HygTK (28–10), which contains the fusion gene of Hyg and HSV1tk genes.

    Plasmid Preparation:

    Article Title: The precision strategy of human genome correction via a set of circular donor DNA and its cleaver
    Article Snippet: .. First, pSelect-zeo-HSV1tk (InvivoGen), cleaved by EcoRI and PstI to remove the ZEO gene, was ligated with the fragment including the Km R gene constructed using KOD-PLUS-DNA polymerase (TOYOBO)-driving PCR on the pCR-BluntII-TOPO plasmid DNA (Invitrogen) with the primer pair 5′-CTT AAT TAA CCT GCA GCC GGA ATT GCC AGC TG-3′ and 5′-ATG TGG TAT GGA ATT CGG TGG CCC TCC TCA CGT GC-3′ using the In-Fusion kit (TOYOBO) to obtain pSelect-Km-HSV1tk (1). .. On the other hand, pSelect-zeo-HSV1tk plasmid DNA (InvivoGen), cleaved by NcoI and SphI followed by blunt-ended treatment with T4 DNA polymerase with dNTPs at 11 °C, was ligated with the fragment including the Hyg gene constructed using KOD-PLUS-DNA polymerase (TOYOBO)-driving PCR on pcDNA3.1/Hygro plasmid with the primer pair 5′-TCA CCG GTC ACC ATG AAA AAG CCT GAA CTC ACC GCG-3′ and 5′-TCA AAG GCA GAA GCA ACT TCT ACA CAG CCA TCG GTC C-3′ using the In-Fusion kit (TOYOBO) to obtain pSelect-zeo-HygTK (28–10), which contains the fusion gene of Hyg and HSV1tk genes.

    Countercurrent Chromatography:

    Article Title: The precision strategy of human genome correction via a set of circular donor DNA and its cleaver
    Article Snippet: .. First, pSelect-zeo-HSV1tk (InvivoGen), cleaved by EcoRI and PstI to remove the ZEO gene, was ligated with the fragment including the Km R gene constructed using KOD-PLUS-DNA polymerase (TOYOBO)-driving PCR on the pCR-BluntII-TOPO plasmid DNA (Invitrogen) with the primer pair 5′-CTT AAT TAA CCT GCA GCC GGA ATT GCC AGC TG-3′ and 5′-ATG TGG TAT GGA ATT CGG TGG CCC TCC TCA CGT GC-3′ using the In-Fusion kit (TOYOBO) to obtain pSelect-Km-HSV1tk (1). .. On the other hand, pSelect-zeo-HSV1tk plasmid DNA (InvivoGen), cleaved by NcoI and SphI followed by blunt-ended treatment with T4 DNA polymerase with dNTPs at 11 °C, was ligated with the fragment including the Hyg gene constructed using KOD-PLUS-DNA polymerase (TOYOBO)-driving PCR on pcDNA3.1/Hygro plasmid with the primer pair 5′-TCA CCG GTC ACC ATG AAA AAG CCT GAA CTC ACC GCG-3′ and 5′-TCA AAG GCA GAA GCA ACT TCT ACA CAG CCA TCG GTC C-3′ using the In-Fusion kit (TOYOBO) to obtain pSelect-zeo-HygTK (28–10), which contains the fusion gene of Hyg and HSV1tk genes.



    Similar Products

    94
    InvivoGen pselect zeo hsv1tk
    Pselect Zeo Hsv1tk, supplied by InvivoGen, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pselect+zeo+hsv1tk/pSELECT-zeo-HSV1tk/pmc13013431-36-1-2
    Average 94 stars, based on 1 article reviews
    pselect zeo hsv1tk - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    InvivoGen pselect zeo hsv1tk plasmid dna
    InCDC is required for efficient targeted duplication. (A–C) A circular donor plasmid, pMB1KmHygTK-HPRT(ISCEI(318)Ex2Syn) (A) , pMB1KmHygTK-HPRT(ISCEI (545)Ex2Syn) (B) , or pMB1KmHygTK-HPRT(Ex2Syn (1195)ISCEI) (C) , along with <t>plasmid</t> <t>DNA</t> expressing the intra-cellular cleavage enzyme nls-I-SceI, was electroporated into the total number of cells transfected indicated in the first column. Alternatively, donor DNA linearized at the ISCEI site alone was electroporated into the total number of cells indicated in the first column. In the next five columns, the numbers show the viable cells transfected, which were calculated by multiplying the number of total cells plated by CFU (colony forming units)/500 total cell on two 9-cm diameter dishes; the overall integration clones as Hyg R colonies generated; the overall integration frequency as the fraction of the Hyg R colonies generated relative to the viable cells transfected; and the targeted duplication clones and the abortion-type clones in brackets, which were doubly positive and singly positive in the duplication test for Hyg R Tg R colonies, respectively. In the last three columns, the frequency of the targeted duplication clones per overall integration (Hyg R ) clone, the numbers of the Syn -retaining targeted duplication clones, and the frequency of the Syn -retaining targeted duplication clones per targeted duplication clone are shown. In these experiments, an advanced DMEM-based culture medium was used to obtain a more corrected value of transfected viable cells as the clonal capacity of the advanced DMEM-based culture medium is greater than that of the DMEM-based culture medium ( Materials and Methods ). The calculations using the Student T-TEST ( Excel ) and CHISQ.TEST ( Excel ) in (A–C) are shown in . The results from the allele sequence test in (A–C) are summarized in . (D) In the “InCDC” table (upper) and “Linearization” table (lower), lanes i and vi show the number of Hyg R clones and Hyg R Tg R clones generated, respectively; lanes ii and vii show the number of Hyg R Tg R clones classified into three types using the duplication test ; lanes iii and viii show each of the Hyg R Tg R clones also classified into two types using the RI test ; lanes iv and ix show the number of each of the forms [TD or non-TD (abortion-type TI and abortion-type RI, TD, or RI] of Hyg R Tg R clones classified, determined based on the two tests above; and lanes v and x show the non-TD frequency per overall integration (Hyg R ) clone. The calculations using the CHISQ.TEST ( Excel ) in panel (D) are shown in .
    Pselect Zeo Hsv1tk Plasmid Dna, supplied by InvivoGen, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pselect+zeo+hsv1tk/pSELECT-zeo-HSV1tk/pmc13013431-37-4-7
    Average 94 stars, based on 1 article reviews
    pselect zeo hsv1tk plasmid dna - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    InvivoGen pcr reaction
    InCDC is required for efficient targeted duplication. (A–C) A circular donor plasmid, pMB1KmHygTK-HPRT(ISCEI(318)Ex2Syn) (A) , pMB1KmHygTK-HPRT(ISCEI (545)Ex2Syn) (B) , or pMB1KmHygTK-HPRT(Ex2Syn (1195)ISCEI) (C) , along with <t>plasmid</t> <t>DNA</t> expressing the intra-cellular cleavage enzyme nls-I-SceI, was electroporated into the total number of cells transfected indicated in the first column. Alternatively, donor DNA linearized at the ISCEI site alone was electroporated into the total number of cells indicated in the first column. In the next five columns, the numbers show the viable cells transfected, which were calculated by multiplying the number of total cells plated by CFU (colony forming units)/500 total cell on two 9-cm diameter dishes; the overall integration clones as Hyg R colonies generated; the overall integration frequency as the fraction of the Hyg R colonies generated relative to the viable cells transfected; and the targeted duplication clones and the abortion-type clones in brackets, which were doubly positive and singly positive in the duplication test for Hyg R Tg R colonies, respectively. In the last three columns, the frequency of the targeted duplication clones per overall integration (Hyg R ) clone, the numbers of the Syn -retaining targeted duplication clones, and the frequency of the Syn -retaining targeted duplication clones per targeted duplication clone are shown. In these experiments, an advanced DMEM-based culture medium was used to obtain a more corrected value of transfected viable cells as the clonal capacity of the advanced DMEM-based culture medium is greater than that of the DMEM-based culture medium ( Materials and Methods ). The calculations using the Student T-TEST ( Excel ) and CHISQ.TEST ( Excel ) in (A–C) are shown in . The results from the allele sequence test in (A–C) are summarized in . (D) In the “InCDC” table (upper) and “Linearization” table (lower), lanes i and vi show the number of Hyg R clones and Hyg R Tg R clones generated, respectively; lanes ii and vii show the number of Hyg R Tg R clones classified into three types using the duplication test ; lanes iii and viii show each of the Hyg R Tg R clones also classified into two types using the RI test ; lanes iv and ix show the number of each of the forms [TD or non-TD (abortion-type TI and abortion-type RI, TD, or RI] of Hyg R Tg R clones classified, determined based on the two tests above; and lanes v and x show the non-TD frequency per overall integration (Hyg R ) clone. The calculations using the CHISQ.TEST ( Excel ) in panel (D) are shown in .
    Pcr Reaction, supplied by InvivoGen, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pselect+zeo+hsv1tk/pSELECT-zeo-HSV1tk/us12252700-854-6-13
    Average 94 stars, based on 1 article reviews
    pcr reaction - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    InvivoGen hsv tk gene
    InCDC is required for efficient targeted duplication. (A–C) A circular donor plasmid, pMB1KmHygTK-HPRT(ISCEI(318)Ex2Syn) (A) , pMB1KmHygTK-HPRT(ISCEI (545)Ex2Syn) (B) , or pMB1KmHygTK-HPRT(Ex2Syn (1195)ISCEI) (C) , along with <t>plasmid</t> <t>DNA</t> expressing the intra-cellular cleavage enzyme nls-I-SceI, was electroporated into the total number of cells transfected indicated in the first column. Alternatively, donor DNA linearized at the ISCEI site alone was electroporated into the total number of cells indicated in the first column. In the next five columns, the numbers show the viable cells transfected, which were calculated by multiplying the number of total cells plated by CFU (colony forming units)/500 total cell on two 9-cm diameter dishes; the overall integration clones as Hyg R colonies generated; the overall integration frequency as the fraction of the Hyg R colonies generated relative to the viable cells transfected; and the targeted duplication clones and the abortion-type clones in brackets, which were doubly positive and singly positive in the duplication test for Hyg R Tg R colonies, respectively. In the last three columns, the frequency of the targeted duplication clones per overall integration (Hyg R ) clone, the numbers of the Syn -retaining targeted duplication clones, and the frequency of the Syn -retaining targeted duplication clones per targeted duplication clone are shown. In these experiments, an advanced DMEM-based culture medium was used to obtain a more corrected value of transfected viable cells as the clonal capacity of the advanced DMEM-based culture medium is greater than that of the DMEM-based culture medium ( Materials and Methods ). The calculations using the Student T-TEST ( Excel ) and CHISQ.TEST ( Excel ) in (A–C) are shown in . The results from the allele sequence test in (A–C) are summarized in . (D) In the “InCDC” table (upper) and “Linearization” table (lower), lanes i and vi show the number of Hyg R clones and Hyg R Tg R clones generated, respectively; lanes ii and vii show the number of Hyg R Tg R clones classified into three types using the duplication test ; lanes iii and viii show each of the Hyg R Tg R clones also classified into two types using the RI test ; lanes iv and ix show the number of each of the forms [TD or non-TD (abortion-type TI and abortion-type RI, TD, or RI] of Hyg R Tg R clones classified, determined based on the two tests above; and lanes v and x show the non-TD frequency per overall integration (Hyg R ) clone. The calculations using the CHISQ.TEST ( Excel ) in panel (D) are shown in .
    Hsv Tk Gene, supplied by InvivoGen, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pselect+zeo+hsv1tk/pSELECT-zeo-HSV1tk/pm37322820-24-16-21
    Average 94 stars, based on 1 article reviews
    hsv tk gene - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    InvivoGen pcpgfree-promoter-lucia
    InCDC is required for efficient targeted duplication. (A–C) A circular donor plasmid, pMB1KmHygTK-HPRT(ISCEI(318)Ex2Syn) (A) , pMB1KmHygTK-HPRT(ISCEI (545)Ex2Syn) (B) , or pMB1KmHygTK-HPRT(Ex2Syn (1195)ISCEI) (C) , along with <t>plasmid</t> <t>DNA</t> expressing the intra-cellular cleavage enzyme nls-I-SceI, was electroporated into the total number of cells transfected indicated in the first column. Alternatively, donor DNA linearized at the ISCEI site alone was electroporated into the total number of cells indicated in the first column. In the next five columns, the numbers show the viable cells transfected, which were calculated by multiplying the number of total cells plated by CFU (colony forming units)/500 total cell on two 9-cm diameter dishes; the overall integration clones as Hyg R colonies generated; the overall integration frequency as the fraction of the Hyg R colonies generated relative to the viable cells transfected; and the targeted duplication clones and the abortion-type clones in brackets, which were doubly positive and singly positive in the duplication test for Hyg R Tg R colonies, respectively. In the last three columns, the frequency of the targeted duplication clones per overall integration (Hyg R ) clone, the numbers of the Syn -retaining targeted duplication clones, and the frequency of the Syn -retaining targeted duplication clones per targeted duplication clone are shown. In these experiments, an advanced DMEM-based culture medium was used to obtain a more corrected value of transfected viable cells as the clonal capacity of the advanced DMEM-based culture medium is greater than that of the DMEM-based culture medium ( Materials and Methods ). The calculations using the Student T-TEST ( Excel ) and CHISQ.TEST ( Excel ) in (A–C) are shown in . The results from the allele sequence test in (A–C) are summarized in . (D) In the “InCDC” table (upper) and “Linearization” table (lower), lanes i and vi show the number of Hyg R clones and Hyg R Tg R clones generated, respectively; lanes ii and vii show the number of Hyg R Tg R clones classified into three types using the duplication test ; lanes iii and viii show each of the Hyg R Tg R clones also classified into two types using the RI test ; lanes iv and ix show the number of each of the forms [TD or non-TD (abortion-type TI and abortion-type RI, TD, or RI] of Hyg R Tg R clones classified, determined based on the two tests above; and lanes v and x show the non-TD frequency per overall integration (Hyg R ) clone. The calculations using the CHISQ.TEST ( Excel ) in panel (D) are shown in .
    Pcpgfree Promoter Lucia, supplied by InvivoGen, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pselect+zeo+hsv1tk/pCpGfree-promoter-Lucia/custom%40pcpgf-promlc%4033992755
    Average 94 stars, based on 1 article reviews
    pcpgfree-promoter-lucia - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    InvivoGen synthetic hsv tk gene
    InCDC is required for efficient targeted duplication. (A–C) A circular donor plasmid, pMB1KmHygTK-HPRT(ISCEI(318)Ex2Syn) (A) , pMB1KmHygTK-HPRT(ISCEI (545)Ex2Syn) (B) , or pMB1KmHygTK-HPRT(Ex2Syn (1195)ISCEI) (C) , along with <t>plasmid</t> <t>DNA</t> expressing the intra-cellular cleavage enzyme nls-I-SceI, was electroporated into the total number of cells transfected indicated in the first column. Alternatively, donor DNA linearized at the ISCEI site alone was electroporated into the total number of cells indicated in the first column. In the next five columns, the numbers show the viable cells transfected, which were calculated by multiplying the number of total cells plated by CFU (colony forming units)/500 total cell on two 9-cm diameter dishes; the overall integration clones as Hyg R colonies generated; the overall integration frequency as the fraction of the Hyg R colonies generated relative to the viable cells transfected; and the targeted duplication clones and the abortion-type clones in brackets, which were doubly positive and singly positive in the duplication test for Hyg R Tg R colonies, respectively. In the last three columns, the frequency of the targeted duplication clones per overall integration (Hyg R ) clone, the numbers of the Syn -retaining targeted duplication clones, and the frequency of the Syn -retaining targeted duplication clones per targeted duplication clone are shown. In these experiments, an advanced DMEM-based culture medium was used to obtain a more corrected value of transfected viable cells as the clonal capacity of the advanced DMEM-based culture medium is greater than that of the DMEM-based culture medium ( Materials and Methods ). The calculations using the Student T-TEST ( Excel ) and CHISQ.TEST ( Excel ) in (A–C) are shown in . The results from the allele sequence test in (A–C) are summarized in . (D) In the “InCDC” table (upper) and “Linearization” table (lower), lanes i and vi show the number of Hyg R clones and Hyg R Tg R clones generated, respectively; lanes ii and vii show the number of Hyg R Tg R clones classified into three types using the duplication test ; lanes iii and viii show each of the Hyg R Tg R clones also classified into two types using the RI test ; lanes iv and ix show the number of each of the forms [TD or non-TD (abortion-type TI and abortion-type RI, TD, or RI] of Hyg R Tg R clones classified, determined based on the two tests above; and lanes v and x show the non-TD frequency per overall integration (Hyg R ) clone. The calculations using the CHISQ.TEST ( Excel ) in panel (D) are shown in .
    Synthetic Hsv Tk Gene, supplied by InvivoGen, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pselect+zeo+hsv1tk/pSELECT-zeo-HSV1tk/pmc07994724-136-17-21
    Average 94 stars, based on 1 article reviews
    synthetic hsv tk gene - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    InvivoGen pselect zeo hsv1tk plasmid
    InCDC is required for efficient targeted duplication. (A–C) A circular donor plasmid, pMB1KmHygTK-HPRT(ISCEI(318)Ex2Syn) (A) , pMB1KmHygTK-HPRT(ISCEI (545)Ex2Syn) (B) , or pMB1KmHygTK-HPRT(Ex2Syn (1195)ISCEI) (C) , along with <t>plasmid</t> <t>DNA</t> expressing the intra-cellular cleavage enzyme nls-I-SceI, was electroporated into the total number of cells transfected indicated in the first column. Alternatively, donor DNA linearized at the ISCEI site alone was electroporated into the total number of cells indicated in the first column. In the next five columns, the numbers show the viable cells transfected, which were calculated by multiplying the number of total cells plated by CFU (colony forming units)/500 total cell on two 9-cm diameter dishes; the overall integration clones as Hyg R colonies generated; the overall integration frequency as the fraction of the Hyg R colonies generated relative to the viable cells transfected; and the targeted duplication clones and the abortion-type clones in brackets, which were doubly positive and singly positive in the duplication test for Hyg R Tg R colonies, respectively. In the last three columns, the frequency of the targeted duplication clones per overall integration (Hyg R ) clone, the numbers of the Syn -retaining targeted duplication clones, and the frequency of the Syn -retaining targeted duplication clones per targeted duplication clone are shown. In these experiments, an advanced DMEM-based culture medium was used to obtain a more corrected value of transfected viable cells as the clonal capacity of the advanced DMEM-based culture medium is greater than that of the DMEM-based culture medium ( Materials and Methods ). The calculations using the Student T-TEST ( Excel ) and CHISQ.TEST ( Excel ) in (A–C) are shown in . The results from the allele sequence test in (A–C) are summarized in . (D) In the “InCDC” table (upper) and “Linearization” table (lower), lanes i and vi show the number of Hyg R clones and Hyg R Tg R clones generated, respectively; lanes ii and vii show the number of Hyg R Tg R clones classified into three types using the duplication test ; lanes iii and viii show each of the Hyg R Tg R clones also classified into two types using the RI test ; lanes iv and ix show the number of each of the forms [TD or non-TD (abortion-type TI and abortion-type RI, TD, or RI] of Hyg R Tg R clones classified, determined based on the two tests above; and lanes v and x show the non-TD frequency per overall integration (Hyg R ) clone. The calculations using the CHISQ.TEST ( Excel ) in panel (D) are shown in .
    Pselect Zeo Hsv1tk Plasmid, supplied by InvivoGen, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pselect+zeo+hsv1tk/pSELECT-zeo-HSV1tk/pmc06906518-154-1-16
    Average 94 stars, based on 1 article reviews
    pselect zeo hsv1tk plasmid - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    InCDC is required for efficient targeted duplication. (A–C) A circular donor plasmid, pMB1KmHygTK-HPRT(ISCEI(318)Ex2Syn) (A) , pMB1KmHygTK-HPRT(ISCEI (545)Ex2Syn) (B) , or pMB1KmHygTK-HPRT(Ex2Syn (1195)ISCEI) (C) , along with plasmid DNA expressing the intra-cellular cleavage enzyme nls-I-SceI, was electroporated into the total number of cells transfected indicated in the first column. Alternatively, donor DNA linearized at the ISCEI site alone was electroporated into the total number of cells indicated in the first column. In the next five columns, the numbers show the viable cells transfected, which were calculated by multiplying the number of total cells plated by CFU (colony forming units)/500 total cell on two 9-cm diameter dishes; the overall integration clones as Hyg R colonies generated; the overall integration frequency as the fraction of the Hyg R colonies generated relative to the viable cells transfected; and the targeted duplication clones and the abortion-type clones in brackets, which were doubly positive and singly positive in the duplication test for Hyg R Tg R colonies, respectively. In the last three columns, the frequency of the targeted duplication clones per overall integration (Hyg R ) clone, the numbers of the Syn -retaining targeted duplication clones, and the frequency of the Syn -retaining targeted duplication clones per targeted duplication clone are shown. In these experiments, an advanced DMEM-based culture medium was used to obtain a more corrected value of transfected viable cells as the clonal capacity of the advanced DMEM-based culture medium is greater than that of the DMEM-based culture medium ( Materials and Methods ). The calculations using the Student T-TEST ( Excel ) and CHISQ.TEST ( Excel ) in (A–C) are shown in . The results from the allele sequence test in (A–C) are summarized in . (D) In the “InCDC” table (upper) and “Linearization” table (lower), lanes i and vi show the number of Hyg R clones and Hyg R Tg R clones generated, respectively; lanes ii and vii show the number of Hyg R Tg R clones classified into three types using the duplication test ; lanes iii and viii show each of the Hyg R Tg R clones also classified into two types using the RI test ; lanes iv and ix show the number of each of the forms [TD or non-TD (abortion-type TI and abortion-type RI, TD, or RI] of Hyg R Tg R clones classified, determined based on the two tests above; and lanes v and x show the non-TD frequency per overall integration (Hyg R ) clone. The calculations using the CHISQ.TEST ( Excel ) in panel (D) are shown in .

    Journal: Frontiers in Genome Editing

    Article Title: The precision strategy of human genome correction via a set of circular donor DNA and its cleaver

    doi: 10.3389/fgeed.2026.1718252

    Figure Lengend Snippet: InCDC is required for efficient targeted duplication. (A–C) A circular donor plasmid, pMB1KmHygTK-HPRT(ISCEI(318)Ex2Syn) (A) , pMB1KmHygTK-HPRT(ISCEI (545)Ex2Syn) (B) , or pMB1KmHygTK-HPRT(Ex2Syn (1195)ISCEI) (C) , along with plasmid DNA expressing the intra-cellular cleavage enzyme nls-I-SceI, was electroporated into the total number of cells transfected indicated in the first column. Alternatively, donor DNA linearized at the ISCEI site alone was electroporated into the total number of cells indicated in the first column. In the next five columns, the numbers show the viable cells transfected, which were calculated by multiplying the number of total cells plated by CFU (colony forming units)/500 total cell on two 9-cm diameter dishes; the overall integration clones as Hyg R colonies generated; the overall integration frequency as the fraction of the Hyg R colonies generated relative to the viable cells transfected; and the targeted duplication clones and the abortion-type clones in brackets, which were doubly positive and singly positive in the duplication test for Hyg R Tg R colonies, respectively. In the last three columns, the frequency of the targeted duplication clones per overall integration (Hyg R ) clone, the numbers of the Syn -retaining targeted duplication clones, and the frequency of the Syn -retaining targeted duplication clones per targeted duplication clone are shown. In these experiments, an advanced DMEM-based culture medium was used to obtain a more corrected value of transfected viable cells as the clonal capacity of the advanced DMEM-based culture medium is greater than that of the DMEM-based culture medium ( Materials and Methods ). The calculations using the Student T-TEST ( Excel ) and CHISQ.TEST ( Excel ) in (A–C) are shown in . The results from the allele sequence test in (A–C) are summarized in . (D) In the “InCDC” table (upper) and “Linearization” table (lower), lanes i and vi show the number of Hyg R clones and Hyg R Tg R clones generated, respectively; lanes ii and vii show the number of Hyg R Tg R clones classified into three types using the duplication test ; lanes iii and viii show each of the Hyg R Tg R clones also classified into two types using the RI test ; lanes iv and ix show the number of each of the forms [TD or non-TD (abortion-type TI and abortion-type RI, TD, or RI] of Hyg R Tg R clones classified, determined based on the two tests above; and lanes v and x show the non-TD frequency per overall integration (Hyg R ) clone. The calculations using the CHISQ.TEST ( Excel ) in panel (D) are shown in .

    Article Snippet: On the other hand, pSelect-zeo-HSV1tk plasmid DNA (InvivoGen), cleaved by NcoI and SphI followed by blunt-ended treatment with T4 DNA polymerase with dNTPs at 11 °C, was ligated with the fragment including the Hyg gene constructed using KOD-PLUS-DNA polymerase (TOYOBO)-driving PCR on pcDNA3.1/Hygro plasmid with the primer pair 5′-TCA CCG GTC ACC ATG AAA AAG CCT GAA CTC ACC GCG-3′ and 5′-TCA AAG GCA GAA GCA ACT TCT ACA CAG CCA TCG GTC C-3′ using the In-Fusion kit (TOYOBO) to obtain pSelect-zeo-HygTK (28–10), which contains the fusion gene of Hyg and HSV1tk genes.

    Techniques: Plasmid Preparation, Expressing, Transfection, Clone Assay, Generated, Sequencing

    Demonstration for naturally generated replacement of the target sequence with the designed sequence. (A) Syn -retaining targeted duplication ( Syn -TD) clone HTG786 (5′ SEXA1 / Syn 3′) or a Syn -TD well clone d9p5F12 is shown with a hetero-allele genotype in the first column. The total cells (third column) were plated onto the dishes (second column). The number of viable cells plated and the density of the viable cells (fourth column) are shown. GCV R /HAT R (ganciclovir-resistant clones/hypoxanthine–aminopterin–thymidine-resistant ( HPRT + ) clones; last column) is shown as the rate of the GCV R frequency (fifth column) relative to that of the HAT R frequency (sixth column). The viable cells plated were calculated by multiplying the number of total cells plated by CFU (colony forming units)/500 total cells. The density of viable cells was calculated by dividing the number of viable cells plated by the area (cm 2 ) of the culture ware used. The GCV R frequency was calculated by dividing the number of all GCV R colonies generated by the viable cells plated. The HAT R frequency was calculated by dividing the total number of HAT R colonies generated or the total number of HAT R colonies calculated from HAT R colonies generated on two dishes by the number of viable cells plated. Adv: Advanced DMEM-based culture medium ( Materials and Methods ) was used to improve viability of HT1080-derived cells on culture ware. (B) Four GCV R clones (GCV-A1–A4) derived from HTG786, two GCV R clones (GCV-B1–B2) derived from HTG786, five GCV R clones (GCV-C1–C5) derived from d9p5F12 (A) , and nine GCV R clones (GCV-D1–D9) derived from d9p5F12 (A) were analyzed using three PCR-based assays as follows: (1) pop-out test ; (2) Hyg test ; and (3) duplication test , with PCR products from each assay electrophoresed (the duplication test was performed to verify whether the duplication structure was retained). HTG786 is a TD clone with 5′ SEXA1 / Syn 3’. HTG1047 is a TD clone with 5′ Syn / SEXA1 3’. (C) A TD structure with SEXA1 / Syn hetero-allele sequences forms one of the two types of natural replacement structures: with the Syn allele (left) or with the SEXA1 allele (right), which was verified by three PCR-based assays as follows: (1) pop-out test (closed blue arrow and open blue arrow) to verify the size characteristic of a natural replacement structure; (2) Hyg test (green arrows) to verify the absence of the Hyg gene because of the popping out of the circular plasmid DNA; and (3) allele sequence test (orange arrows) to determine the sequence of the allele of a replacement clone. One TD clone HTG786 is shown in the first column. In the following five columns, the numbers show the obtained GCV R or HAT R colonies, the Syn allele clones, the SEXA1 allele clones, the TK-deficient TD clones, in which duplication tests were still positive in panel (B) , and the others (TD-derived deletion clones, in which all of pop-out test, Hyg test, and duplication test were negative in panel (B) ). The complete results of the Syn allele or the SEXA1 allele of pop-out-type GCV or HAT clones are summarized in . The complete results of the HygTK sequence in TK-deficient TD-type GCV clones are summarized in .

    Journal: Frontiers in Genome Editing

    Article Title: The precision strategy of human genome correction via a set of circular donor DNA and its cleaver

    doi: 10.3389/fgeed.2026.1718252

    Figure Lengend Snippet: Demonstration for naturally generated replacement of the target sequence with the designed sequence. (A) Syn -retaining targeted duplication ( Syn -TD) clone HTG786 (5′ SEXA1 / Syn 3′) or a Syn -TD well clone d9p5F12 is shown with a hetero-allele genotype in the first column. The total cells (third column) were plated onto the dishes (second column). The number of viable cells plated and the density of the viable cells (fourth column) are shown. GCV R /HAT R (ganciclovir-resistant clones/hypoxanthine–aminopterin–thymidine-resistant ( HPRT + ) clones; last column) is shown as the rate of the GCV R frequency (fifth column) relative to that of the HAT R frequency (sixth column). The viable cells plated were calculated by multiplying the number of total cells plated by CFU (colony forming units)/500 total cells. The density of viable cells was calculated by dividing the number of viable cells plated by the area (cm 2 ) of the culture ware used. The GCV R frequency was calculated by dividing the number of all GCV R colonies generated by the viable cells plated. The HAT R frequency was calculated by dividing the total number of HAT R colonies generated or the total number of HAT R colonies calculated from HAT R colonies generated on two dishes by the number of viable cells plated. Adv: Advanced DMEM-based culture medium ( Materials and Methods ) was used to improve viability of HT1080-derived cells on culture ware. (B) Four GCV R clones (GCV-A1–A4) derived from HTG786, two GCV R clones (GCV-B1–B2) derived from HTG786, five GCV R clones (GCV-C1–C5) derived from d9p5F12 (A) , and nine GCV R clones (GCV-D1–D9) derived from d9p5F12 (A) were analyzed using three PCR-based assays as follows: (1) pop-out test ; (2) Hyg test ; and (3) duplication test , with PCR products from each assay electrophoresed (the duplication test was performed to verify whether the duplication structure was retained). HTG786 is a TD clone with 5′ SEXA1 / Syn 3’. HTG1047 is a TD clone with 5′ Syn / SEXA1 3’. (C) A TD structure with SEXA1 / Syn hetero-allele sequences forms one of the two types of natural replacement structures: with the Syn allele (left) or with the SEXA1 allele (right), which was verified by three PCR-based assays as follows: (1) pop-out test (closed blue arrow and open blue arrow) to verify the size characteristic of a natural replacement structure; (2) Hyg test (green arrows) to verify the absence of the Hyg gene because of the popping out of the circular plasmid DNA; and (3) allele sequence test (orange arrows) to determine the sequence of the allele of a replacement clone. One TD clone HTG786 is shown in the first column. In the following five columns, the numbers show the obtained GCV R or HAT R colonies, the Syn allele clones, the SEXA1 allele clones, the TK-deficient TD clones, in which duplication tests were still positive in panel (B) , and the others (TD-derived deletion clones, in which all of pop-out test, Hyg test, and duplication test were negative in panel (B) ). The complete results of the Syn allele or the SEXA1 allele of pop-out-type GCV or HAT clones are summarized in . The complete results of the HygTK sequence in TK-deficient TD-type GCV clones are summarized in .

    Article Snippet: On the other hand, pSelect-zeo-HSV1tk plasmid DNA (InvivoGen), cleaved by NcoI and SphI followed by blunt-ended treatment with T4 DNA polymerase with dNTPs at 11 °C, was ligated with the fragment including the Hyg gene constructed using KOD-PLUS-DNA polymerase (TOYOBO)-driving PCR on pcDNA3.1/Hygro plasmid with the primer pair 5′-TCA CCG GTC ACC ATG AAA AAG CCT GAA CTC ACC GCG-3′ and 5′-TCA AAG GCA GAA GCA ACT TCT ACA CAG CCA TCG GTC C-3′ using the In-Fusion kit (TOYOBO) to obtain pSelect-zeo-HygTK (28–10), which contains the fusion gene of Hyg and HSV1tk genes.

    Techniques: Generated, Sequencing, Clone Assay, Derivative Assay, Plasmid Preparation

    Structures of the Syn allele and the SEXA1 allele in targeted duplication. (A) The Syn position of TD clones was verified by a couple of PCR-based tests as follows: (1) The 3.0-kb PCR with target-5′-outside forward primer 2 (closed blue arrow) and Syn reverse primer (opened green arrow: 5′-GCA​AAA​GAG​GTC​GAG​ATC​GTA​GCC-3′); (2) the 3.1-kb PCR with Syn forward primer (closed green arrow: 5′-GAA​CCA​GGC​TAC​GAT​CTC​GAC​CTC-3′) and target-3′-outside forward primer 2 (opened blue arrow). The 5′ Syn / SEXA1 3′ form leads to only the PCR product with the Syn reverse primer (upper). The 5′ SEXA1 / Syn 3′ form leads to only the PCR product with the Syn forward primer (middle). The 5′ Syn / Syn 3′ form leads to both types of PCR products (bottom). (B) The PCR products obtained from the above two tests for HTG-A1–A12, HTG-B1–B9, and HTG-C1∼C10 are shown by electrophoresis, which shows that 15, 5, 2, and 1 out of 23 TD clones were 5′ SEXA1 / SEXA1 3′, 5′ Syn / SEXA1 3′, 5′ SEXA1 / Syn 3′, and 5′ Syn / Syn 3′, respectively. HTG786 is a TD clone with 5′ SEXA1 / Syn 3’. HTG1047 is a TD clone with 5′ Syn / SEXA1 3’. (C–F) Crossover-type homologous recombination reactions produce four types of TD products: 5′ SEXA1 / SEXA1 3′, 5′ Syn / SEXA1 3′, 5′ SEXA1 / Syn 3′, and 5′ Syn / Syn 3’. Their reactions are explained as follows: 1. a donor plasmid DNA with a designed sequence (green) is cleaved at the ISCEI site within cells. 2. The double-strand break ends are resected by a putative exonuclease to form the double-strand gap. 3. The double-strand gap ends receive 5′-end resections to form the 3′-single-strand tails. 4. A 3′-single-strand tail is invaded into the homologous duplex of the chromosome to form the D-loop intermediate. 5. The D-loop intermediate is converted through strand exchange into the primed Holliday junction. 6. The repair synthesis starts at the 3′-end of the strand, which is stabilized in a structure of the primed Holliday junction to form the double Holliday junction. 7. The primed Holliday junction is horizontally resolved to form the single Holliday junction. 8. The single Holliday junction is vertically resolved to form the doublet structure comprising the donor DNA (green) and the chromosomal target DNA (blue), which possesses the donor allele duplex and the target allele duplex. Second on (C,D): A putative exonuclease degrades but remains the designed sequence of the donor DNA and forms the double-strand gap, which leads to the 5′ Syn / SEXA1 3′ doublet structure. However, when a putative exonuclease degrades beyond the designed sequence of the donor DNA and forms the longer double-strand gap, it leads to the 5′ SEXA1 / SEXA1 3′ doublet structure. Third on (E): When the double-strand gap ends receive the 5′-end resections associated with longer processivity to form the longer 3′-single-strand tail, it leads to the doublet structure with the single mismatch (seventh and eighth on (E) ) and produces the 5′ SEXA1 / Syn 3′ doublet structure after a DNA replication fork passes or the mismatch is repaired (ninth on (E) ). Fifth on (F): When the D-loop intermediate is converted through the branch migration associated with longer processivity to form another type of primed Holliday junction beyond the designed sequence, it leads to the doublet structure with the double mismatch (seventh and eighth on (F) ) and produces the 5′ Syn / Syn 3′ doublet structure after the double mismatch is repaired (ninth on (F) ).

    Journal: Frontiers in Genome Editing

    Article Title: The precision strategy of human genome correction via a set of circular donor DNA and its cleaver

    doi: 10.3389/fgeed.2026.1718252

    Figure Lengend Snippet: Structures of the Syn allele and the SEXA1 allele in targeted duplication. (A) The Syn position of TD clones was verified by a couple of PCR-based tests as follows: (1) The 3.0-kb PCR with target-5′-outside forward primer 2 (closed blue arrow) and Syn reverse primer (opened green arrow: 5′-GCA​AAA​GAG​GTC​GAG​ATC​GTA​GCC-3′); (2) the 3.1-kb PCR with Syn forward primer (closed green arrow: 5′-GAA​CCA​GGC​TAC​GAT​CTC​GAC​CTC-3′) and target-3′-outside forward primer 2 (opened blue arrow). The 5′ Syn / SEXA1 3′ form leads to only the PCR product with the Syn reverse primer (upper). The 5′ SEXA1 / Syn 3′ form leads to only the PCR product with the Syn forward primer (middle). The 5′ Syn / Syn 3′ form leads to both types of PCR products (bottom). (B) The PCR products obtained from the above two tests for HTG-A1–A12, HTG-B1–B9, and HTG-C1∼C10 are shown by electrophoresis, which shows that 15, 5, 2, and 1 out of 23 TD clones were 5′ SEXA1 / SEXA1 3′, 5′ Syn / SEXA1 3′, 5′ SEXA1 / Syn 3′, and 5′ Syn / Syn 3′, respectively. HTG786 is a TD clone with 5′ SEXA1 / Syn 3’. HTG1047 is a TD clone with 5′ Syn / SEXA1 3’. (C–F) Crossover-type homologous recombination reactions produce four types of TD products: 5′ SEXA1 / SEXA1 3′, 5′ Syn / SEXA1 3′, 5′ SEXA1 / Syn 3′, and 5′ Syn / Syn 3’. Their reactions are explained as follows: 1. a donor plasmid DNA with a designed sequence (green) is cleaved at the ISCEI site within cells. 2. The double-strand break ends are resected by a putative exonuclease to form the double-strand gap. 3. The double-strand gap ends receive 5′-end resections to form the 3′-single-strand tails. 4. A 3′-single-strand tail is invaded into the homologous duplex of the chromosome to form the D-loop intermediate. 5. The D-loop intermediate is converted through strand exchange into the primed Holliday junction. 6. The repair synthesis starts at the 3′-end of the strand, which is stabilized in a structure of the primed Holliday junction to form the double Holliday junction. 7. The primed Holliday junction is horizontally resolved to form the single Holliday junction. 8. The single Holliday junction is vertically resolved to form the doublet structure comprising the donor DNA (green) and the chromosomal target DNA (blue), which possesses the donor allele duplex and the target allele duplex. Second on (C,D): A putative exonuclease degrades but remains the designed sequence of the donor DNA and forms the double-strand gap, which leads to the 5′ Syn / SEXA1 3′ doublet structure. However, when a putative exonuclease degrades beyond the designed sequence of the donor DNA and forms the longer double-strand gap, it leads to the 5′ SEXA1 / SEXA1 3′ doublet structure. Third on (E): When the double-strand gap ends receive the 5′-end resections associated with longer processivity to form the longer 3′-single-strand tail, it leads to the doublet structure with the single mismatch (seventh and eighth on (E) ) and produces the 5′ SEXA1 / Syn 3′ doublet structure after a DNA replication fork passes or the mismatch is repaired (ninth on (E) ). Fifth on (F): When the D-loop intermediate is converted through the branch migration associated with longer processivity to form another type of primed Holliday junction beyond the designed sequence, it leads to the doublet structure with the double mismatch (seventh and eighth on (F) ) and produces the 5′ Syn / Syn 3′ doublet structure after the double mismatch is repaired (ninth on (F) ).

    Article Snippet: On the other hand, pSelect-zeo-HSV1tk plasmid DNA (InvivoGen), cleaved by NcoI and SphI followed by blunt-ended treatment with T4 DNA polymerase with dNTPs at 11 °C, was ligated with the fragment including the Hyg gene constructed using KOD-PLUS-DNA polymerase (TOYOBO)-driving PCR on pcDNA3.1/Hygro plasmid with the primer pair 5′-TCA CCG GTC ACC ATG AAA AAG CCT GAA CTC ACC GCG-3′ and 5′-TCA AAG GCA GAA GCA ACT TCT ACA CAG CCA TCG GTC C-3′ using the In-Fusion kit (TOYOBO) to obtain pSelect-zeo-HygTK (28–10), which contains the fusion gene of Hyg and HSV1tk genes.

    Techniques: Clone Assay, Electrophoresis, Homologous Recombination, Plasmid Preparation, Sequencing, Migration

    Verification of the generality of PCR screening methods to isolate the targeted duplication clones out of overall integration clones. (A) Upper panel: A circular donor plasmid, pMB1KmHygTK-HPRT(ISCEI(545)Ex2Syn) was transfected to convert the SEXA1 allele of HT1080 to the Syn allele through intra-cellular circular donor cleavage (InCDC)-mediated targeted duplication (TD) and natural replacement. In line i, the sequence of the target allele ( SEXA1 ) in the HT1080 cell line is shown, which has original codons (blue letters) in exon 2 of the HPRT gene. The bold upper-lined letters are the SEXA1 site. In line ii, the sequence of the designed allele ( Syn ) is shown, which has synonymous codons (green letters) overlapped with the SEXA1 site. Lower panel [Targeted duplication (TD) screening of HT1080]: In lane iii, in the first three columns, the numbers show the total cells transfected by electroporation and the hygromycin-resistant (Hyg R ) colonies generated, and the TD dishes identified by PCR analysis for the bulk of the Hyg R colonies on every dish of the 16 dishes are shown. In the next two columns, the ID of the TD dishes identified and the presence or absence of the Syn allele in each of the TD dishes are shown. In the last two columns, the numbers of Syn -TD wells/TD wells/cell-growing wells in three 96-well plates [upper: feeder (HT1080 cell line) wells; lower: feeder-free wells] and their ID of the Syn -retaining TD wells identified are shown. The viability of cells derived from a #9-dish stock in 96-well plates was not significantly improved by the coexistence with feeder cells ( Materials and Methods ). (B) Upper panel: The Syn -retaining TD dishes, which contain targeted duplication clones with Syn allele sequences, were screened using two PCR-based assays as follows: the TD-screening PCR with the plasmid-5′-inside forward primer (opened violet arrow) and the target-3′-outside reverse primer (opened blue arrow); the Syn -retaining TD-screening PCR with the target-5′-outside forward primer (closed blue arrow) and the Syn reverse primer (opened green arrow). Lower left panel: The circular donor plasmid, pMB1KmHygTK-HPRT(ISCEI(545)Ex2Syn), was transfected, and the resultant 16 dishes were screened by TD screening PCR and Syn -TD screening PCR, with both PCR products electrophoresed, leading to the identification of Syn -retaining TD dish #9. Lower right panel: Six wells of 96-well plates were identified as Syn -TD clones derived from #9-dish stock by TD screening PCR and Syn -TD screening PCR, with both PCR products electrophoresed, leading to the identification of six Syn -retaining TD wells. HTG-A4 is a TD clone with 5′ Syn / SEXA1 3’. (C) A TD structure with Syn / SEXA1 hetero-allele sequences forms one of the two types of natural replacement structures: with the Syn allele (left) or with the SEXA1 allele (right), which was verified using three PCR-based tests: (1) pop-out test (closed blue arrow and open blue arrow) to verify a natural replacement structure; (2) Hyg test (green arrows) to verify the popping out of the circular plasmid DNA; and (3) allele sequence test (orange arrows) to determine either allele of a replacement clone. One TD well-clone d9p5F12 is shown in the first column. In the following five columns, the numbers show the obtained GCV R colonies, Syn allele clones, SEXA1 allele clones, and TK-deficient TD clones, in which duplication tests were still positive , and others [TD-derived deletion clones, in which all of pop-out test, Hyg test, and duplication test were negative ]. The complete results of the Syn allele or the SEXA1 allele of pop-out type GCV clones are summarized in . The complete results of the HygTK sequence of TK-deficient TD-type GCV clones are summarized in . Upper panel: The sequence data from the Syn clones identified using the allele sequence test among HTG786-derived pop-out type GCV R clones (lanes i and ii in ) are shown, each of which was the singlet chart of the Syn allele sequence. Lower panel: The sequence data from the Syn clones identified using the allele sequence test among d9p5F12 -derived pop-out-type GCV R clones (lanes i and ii in ) are shown, each of which was the singlet chart of the Syn allele sequence. The sequence data from their SEXA1 clones are also shown in .

    Journal: Frontiers in Genome Editing

    Article Title: The precision strategy of human genome correction via a set of circular donor DNA and its cleaver

    doi: 10.3389/fgeed.2026.1718252

    Figure Lengend Snippet: Verification of the generality of PCR screening methods to isolate the targeted duplication clones out of overall integration clones. (A) Upper panel: A circular donor plasmid, pMB1KmHygTK-HPRT(ISCEI(545)Ex2Syn) was transfected to convert the SEXA1 allele of HT1080 to the Syn allele through intra-cellular circular donor cleavage (InCDC)-mediated targeted duplication (TD) and natural replacement. In line i, the sequence of the target allele ( SEXA1 ) in the HT1080 cell line is shown, which has original codons (blue letters) in exon 2 of the HPRT gene. The bold upper-lined letters are the SEXA1 site. In line ii, the sequence of the designed allele ( Syn ) is shown, which has synonymous codons (green letters) overlapped with the SEXA1 site. Lower panel [Targeted duplication (TD) screening of HT1080]: In lane iii, in the first three columns, the numbers show the total cells transfected by electroporation and the hygromycin-resistant (Hyg R ) colonies generated, and the TD dishes identified by PCR analysis for the bulk of the Hyg R colonies on every dish of the 16 dishes are shown. In the next two columns, the ID of the TD dishes identified and the presence or absence of the Syn allele in each of the TD dishes are shown. In the last two columns, the numbers of Syn -TD wells/TD wells/cell-growing wells in three 96-well plates [upper: feeder (HT1080 cell line) wells; lower: feeder-free wells] and their ID of the Syn -retaining TD wells identified are shown. The viability of cells derived from a #9-dish stock in 96-well plates was not significantly improved by the coexistence with feeder cells ( Materials and Methods ). (B) Upper panel: The Syn -retaining TD dishes, which contain targeted duplication clones with Syn allele sequences, were screened using two PCR-based assays as follows: the TD-screening PCR with the plasmid-5′-inside forward primer (opened violet arrow) and the target-3′-outside reverse primer (opened blue arrow); the Syn -retaining TD-screening PCR with the target-5′-outside forward primer (closed blue arrow) and the Syn reverse primer (opened green arrow). Lower left panel: The circular donor plasmid, pMB1KmHygTK-HPRT(ISCEI(545)Ex2Syn), was transfected, and the resultant 16 dishes were screened by TD screening PCR and Syn -TD screening PCR, with both PCR products electrophoresed, leading to the identification of Syn -retaining TD dish #9. Lower right panel: Six wells of 96-well plates were identified as Syn -TD clones derived from #9-dish stock by TD screening PCR and Syn -TD screening PCR, with both PCR products electrophoresed, leading to the identification of six Syn -retaining TD wells. HTG-A4 is a TD clone with 5′ Syn / SEXA1 3’. (C) A TD structure with Syn / SEXA1 hetero-allele sequences forms one of the two types of natural replacement structures: with the Syn allele (left) or with the SEXA1 allele (right), which was verified using three PCR-based tests: (1) pop-out test (closed blue arrow and open blue arrow) to verify a natural replacement structure; (2) Hyg test (green arrows) to verify the popping out of the circular plasmid DNA; and (3) allele sequence test (orange arrows) to determine either allele of a replacement clone. One TD well-clone d9p5F12 is shown in the first column. In the following five columns, the numbers show the obtained GCV R colonies, Syn allele clones, SEXA1 allele clones, and TK-deficient TD clones, in which duplication tests were still positive , and others [TD-derived deletion clones, in which all of pop-out test, Hyg test, and duplication test were negative ]. The complete results of the Syn allele or the SEXA1 allele of pop-out type GCV clones are summarized in . The complete results of the HygTK sequence of TK-deficient TD-type GCV clones are summarized in . Upper panel: The sequence data from the Syn clones identified using the allele sequence test among HTG786-derived pop-out type GCV R clones (lanes i and ii in ) are shown, each of which was the singlet chart of the Syn allele sequence. Lower panel: The sequence data from the Syn clones identified using the allele sequence test among d9p5F12 -derived pop-out-type GCV R clones (lanes i and ii in ) are shown, each of which was the singlet chart of the Syn allele sequence. The sequence data from their SEXA1 clones are also shown in .

    Article Snippet: On the other hand, pSelect-zeo-HSV1tk plasmid DNA (InvivoGen), cleaved by NcoI and SphI followed by blunt-ended treatment with T4 DNA polymerase with dNTPs at 11 °C, was ligated with the fragment including the Hyg gene constructed using KOD-PLUS-DNA polymerase (TOYOBO)-driving PCR on pcDNA3.1/Hygro plasmid with the primer pair 5′-TCA CCG GTC ACC ATG AAA AAG CCT GAA CTC ACC GCG-3′ and 5′-TCA AAG GCA GAA GCA ACT TCT ACA CAG CCA TCG GTC C-3′ using the In-Fusion kit (TOYOBO) to obtain pSelect-zeo-HygTK (28–10), which contains the fusion gene of Hyg and HSV1tk genes.

    Techniques: Clone Assay, Plasmid Preparation, Transfection, Sequencing, Electroporation, Generated, Derivative Assay